w3resource

C++ String: Exercises, Practice, Solution

C++ String [42 exercises with solution]

[An editor is available at the bottom of the page to write and execute the scripts. Go to the editor]

1. Write a C++ program to reverse a given string.
Example:
Sample Input: w3resource
Sample Output: ecruoser3w
Click me to see the sample solution

2. Write a C++ program to change every letter in a given string with the letter following it in the alphabet (i.e. a becomes b, p becomes q, z becomes a).
Example:
Sample Input: w3resource
Sample Output: x3sftpvsdf
Click me to see the sample solution

3. Write a C++ program to capitalize the first letter of each word in a given string. Words must be separated by only one space.
Example:
Sample Input: cpp string exercises
Sample Output: Cpp String Exercises
Click me to see the sample solution

4. Write a C++ program to find the largest word in a given string.
Example:
Sample Input: C++ is a general-purpose programming language.
Sample Output: programming
Click me to see the sample solution

5. Write a C++ program to sort characters (numbers and punctuation symbols are not included) in a string.
Example:
Sample Input: python
Sample Output: hnopty
Click me to see the sample solution

6. Write a C++ program to check whether the characters e and g are separated by exactly 2 places anywhere in a given string at least once.
+ Example:
Sample Input: eagerer
Sample Output: eagerer -> 1
Click me to see the sample solution

7. Write a C++ program to count all the vowels in a given string.
Example:
Sample Input: eagerer
Sample output: number of vowels -> 4
Click me to see the sample solution

8. Write a C++ program to count all the words in a given string.
Example:
Sample Input: Python
Sample Output: number of words -> 1
Click me to see the sample solution

9. Write a C++ program to check whether two characters appear equally in a given string.
Example:
Sample Input: aabcdeef
Sample Output: True
Click me to see the sample solution

10. Write a C++ program to check if a given string is a Palindrome or not.
A palindrome is a word, number, phrase, or other sequence of characters which reads the same backward as forward, such as madam, racecar.
Example:
Sample Input: madam
Sample Output: True
Click me to see the sample solution

11. Write a C++ program to find a word in a given string that has the highest number of repeated letters.
Example:
Sample Input: Print a welcome text in a separate line.
Sample Output: Word which has the highest number of repeated letters. separate
Click me to see the sample solution

12. Write a C++ program to insert a dash character (-) between two odd numbers in a given string of numbers.
Example:
Sample Input: 1345789
Sample Output: Result-> 1-345-789
Click me to see the sample solution

13. Write a C++ program to change the case (lower to upper and upper to lower cases) of each character in a given string.
Example:
Sample Input: Pythpn
Sample Output: pYTHON
Click me to see the sample solution

14. Write a C++ program to find the numbers in a given string and calculate the sum of all numbers.
Example:
Sample Input: w3resource from 2008
Sample Output: Sum of the numbers: 2011
Click me to see the sample solution

15. Write a C++ program to convert a given non-negative integer into English words.
Example:
Sample Input: 12
Sample Output: Twelve
Sample Input: 29
Sample Output: Twenty Nine
Click me to see the sample solution

16. Write a C++ program to find the longest common prefix from a given array of strings.
Example:
The longest common prefix is: Pa
The longest common prefix is: J
The longest common prefix is:
Click me to see the sample solution

17. Write a C++ program to find all combinations of well-formed brackets from a given pair of parentheses.
Example:
n = 2
[[]] [][]
n = 3
[[]] [][] [[[]]] [[][]] [[]][] [][[]] [][][]
Click me to see the sample solution

18. Write a C++ program to find the length of the longest valid (correct-formed) parentheses substring of a given string.
Example:
Original Parentheses string: [[]
Length of longest parentheses: 2
Original Parentheses string: [[]]]
Length of longest parentheses: 4
Original Parentheses string: ]]]][[[[
Length of longest parentheses: 0
Click me to see the sample solution

19. Write a C++ program to reverse only the vowels of a given string.
A vowel is a syllabic speech sound pronounced without any stricture in the vocal tract. Vowels are one of the two principal classes of speech sounds, the other being the consonant.
Example:
Original string: w3resource
After reversing the vowels of the said string: w3resuorce
Original string: Python
After reversing the vowels of the said string: Python
Original string: Hello
After reversing the vowels of the said string: Holle
Original string: USA
After reversing the vowels of the said string: ASU
Click me to see the sample solution

20. Write a C++ program to find the length of the longest palindrome in a given string (uppercase or lowercase letters).
Original string: adcdcdy
Length of the longest palindrome of the said string: 5
Original string: aaa
Length of the longest palindrome of the said string: 3
Original string: aa
Length of the longest palindrome of the said string: 2
Original string: abddddeeff
Length of the longest palindrome of the said string: 4
Original string: PYTHON
Length of the longest palindrome of the said string: 1
Click me to see the sample solution

21. Write a C++ program to check whether a given string is a subsequence of another given string. Return 1 for true and 0 for false.
Example:
word1: apple
subse1: apl
Is subse1 is the subsequence of word1? 1
word2: apple
subse2: ppe
Is subse2 is the subsequence of word2? 1
word3: ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
subse3: CGTTCGGCTATGCTTCTACTTATTCTA
Is subse3 is the subsequence of word3? 1
word4: CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
subse4: CGTTCGGCTATGCZTTCTACTTATTCTA
Is subse4 is the subsequence of word4? 0
Click me to see the sample solution

22. Write a C++ program to remove all special characters from a given string.
Example:
Original string: abcd $ js# @acde$
New string after removing the special characters from the said string:
abcd js acde
Click me to see the sample solution

23. Write a C++ program that counts the number of unique characters in two given strings.
Example:
Original Strings:
String1: Python
String2: Java
Total number of unique characters of the said two strings: 9
Click me to see the sample solution

24. Write a C++ program to count the number of duplicate characters in a given string.
Example:
Original String:
Total number of unique characters of the said two strings.
Number of duplicate characters in the said string: 36
Click me to see the sample solution

25. Write a C++ program to find the longest sequence of consecutive ones in a given binary string.
Example:
Original Binary String:
1100110001
Longest sequence of consecutive ones of the said binary string:
11
Click me to see the sample solution

26. Write a C++ program to check if a given string is a title-cased string or not. When the string is title cased, return "True", otherwise return "False".
Example:
Original String:
The Quick Brown Fox.
Check the said string is a title cased string or not!
True
Click me to see the sample solution

27. Write a C++ program to insert a space when a lower character follows an upper character in a given string.
Example:
Original String:
TheQuickBrownFox.
Insert white spaces between lower and uppercase Letters in the said string:
The Quick Brown Fox.
Click me to see the sample solution

28. Write a C++ program to extract the first specified number of vowels from a given string. If the specified number is less than the number of vowels present in the text, display "n is less than the number of vowels present in the string".
Example:
Input a string: Input a number:
Extract the first n number of vowels from the said string:
n is less than number of vowels present in the string!
Click me to see the sample solution

29. Write a C++ program to print a given integer with commas separating the thousands.
Example:
Input a number:
Print the said integer with commas as thousands separators:
5,000
Click me to see the sample solution

30. Write a C++ program to identify the missing letter in a given string (list of alphabets). The method returns, "There is no missing letter!" if no letters are missing from the string.
Example:
Original string: abcdef
Identify the missing letter in the said string:
There is no missing letter!
Click me to see the sample solution

31. Write a C++ program to check if a given string contains only uppercase or only lowercase letters. Return "True" if the string is uppercase or lowercase, otherwise "False".
Example:
Original string: ABCDEF
Check whether the said string is uppercase or lowercase: True
Click me to see the sample solution

32. Write a C++ program that takes a string and reverses the words of three or more lengths in a string. Return the updated string. As input characters, only spaces and letters are permitted.
Example:
Original string: The quick brown fox jumps over the lazy dog
Reverse the words of three or more lengths of the said string:
ehT kciuq nworb xof spmuj revo eht yzal god
Click me to see the sample solution

33. A string is created using the letters of another string. Letters are case sensitive. Write a C++ program to verify that the letters in the second string appear in the first string. Return true otherwise false.
Test Data:
("CPP", "Cpp") -> false
("Java", "Ja") -> true
("Check first string", "sifC") ->true
Click me to see the sample solution

34. Write a C++ program that removes a specific word from a given string. Return the updated string.
Test Data:
("Exercises Practice Solution", "Solution") -> "Exercises Practice"
("Exercises Practice Solution", "Practice ") -> "Exercises Solution"
("Exercises Practice Solution", " Solution") -> " Practice Solution"
Click me to see the sample solution

35. Write a C++ program to reverse all words that have odd lengths in a string.
Test Data:
("Exercises Practice Solution" ) -> "sesicrexE Practice Solution"
("The quick brown fox jumps over the lazy dog") -> "ehT kciuq nworb xof spmuj over eht lazy dog."
Click me to see the sample solution

36. Write a C++ program to check whether there are two consecutive (following each other continuously), identical letters in a given string.
Test Data:
("Exercises") -> 0
("Yellow") -> 1
Click me to see the sample solution

37. Write a C++ program that counts the number of instances of a certain character in a given string.
Test Data:
("Exercises", "e") -> 2
("Compilation Time", "i") -> 3
Click me to see the sample solution

38. Write a C++ program that removes a specific character from a given string. Return the updated string.
Test Data:
("Filename", "e") -> "Filnam"
("Compilation Time", "i") -> "Complaton Tme"
Click me to see the sample solution

39. Write a C++ program that checks whether a given string contains unique characters or not. Return true if the string contains unique characters otherwise false.
Test Data:
("Filename") -> 0
("abc") -> 1
Click me to see the sample solution

40. For two given strings, str1 and str2, write a C++ program to select only the characters that are lowercase in the other string at the same position. Return characters as a single string.
Test Data:
("Java", "jscript") -> "scr"
("jScript", "Java") -> "Jva"
("cpp", "c++") -> "c++"
Click me to see the sample solution

41. Write a C++ program that finds the position of the second occurrence of a string in another string. If the substring does not appear at least twice return -1.
Test Data:
("the qu qu", "qu") -> 7
("theququ", "qu") -> 5
("thequ", "qu") -> -1
Click me to see the sample solution

42. Write a C++ program that alternates the case of each letter in a given string of letters.
Pattern: First lowercase letter then uppercase letter and so on.
Test Data:
("JavaScript") -> "jAvAsCrIpT"
("Python") -> "pYtHoN"
("C++") -> "c++"
Click me to see the sample solution

CPP Code Editor:

More to Come !

Do not submit any solution of the above exercises at here, if you want to contribute go to the appropriate exercise page.



Become a Patron!

Follow us on Facebook and Twitter for latest update.

It will be nice if you may share this link in any developer community or anywhere else, from where other developers may find this content. Thanks.

https://w3resource.com/cpp-exercises/string/index.php